【病毒外文文獻(xiàn)】2019 Severe Acute Respiratory Syndrome Coronavirus Viroporin 3a Activates the NLRP3 Inflammasome

《【病毒外文文獻(xiàn)】2019 Severe Acute Respiratory Syndrome Coronavirus Viroporin 3a Activates the NLRP3 Inflammasome》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2019 Severe Acute Respiratory Syndrome Coronavirus Viroporin 3a Activates the NLRP3 Inflammasome（9頁(yè)珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

fmicb 10 00050 January 25 2019 Time 17 49 1 ORIGINAL RESEARCH published 29 January 2019 doi 10 3389 fmicb 2019 00050 Edited by Koichi Watashi National Institute of Infectious Diseases NIID Japan Reviewed by Heung Kyu Lee Korea Advanced Institute of Science and Technology KAIST South Korea Yoshikazu Fujimoto Kagoshima University Japan Correspondence Takeshi Ichinohe ichinohe ims u tokyo ac jp Specialty section This article was submitted to Virology a section of the journal Frontiers in Microbiology Received 05 December 2018 Accepted 14 January 2019 Published 29 January 2019 Citation Chen IY Moriyama M Chang MF and Ichinohe T 2019 Severe Acute Respiratory Syndrome Coronavirus Viroporin 3a Activates the NLRP3 Inflammasome Front Microbiol 10 50 doi 10 3389 fmicb 2019 00050 Severe Acute Respiratory Syndrome Coronavirus Viroporin 3a Activates the NLRP3 Inflammasome I Yin Chen1 Miyu Moriyama1 Ming Fu Chang2 and Takeshi Ichinohe1 1 Division of Viral Infection Department of Infectious Disease Control International Research Center for Infectious Diseases Institute of Medical Science The University of Tokyo Tokyo Japan 2 Institute of Biochemistry and Molecular Biology National Taiwan University College of Medicine Taipei Taiwan Nod like receptor family pyrin domain containing 3 NLRP3 regulates the secretion of proinflammatory cytokines interleukin 1 beta IL 1b and IL 18 We previously showed that influenza virus M2 or encephalomyocarditis virus EMCV 2B proteins stimulate IL 1b secretion following activation of the NLRP3 inflammasome However the mechanism by which severe acute respiratory syndrome coronavirus SARS CoV activates the NLRP3 inflammasome remains unknown Here we provide direct evidence that SARS CoV 3a protein activates the NLRP3 inflammasome in lipopolysaccharide primed macrophages SARS CoV 3a was sufficient to cause the NLRP3 inflammasome activation The ion channel activity of the 3a protein was essential for 3a mediated IL 1b secretion While cells uninfected or infected with a lentivirus expressing a 3a protein defective in ion channel activity expressed NLRP3 uniformly throughout the cytoplasm NLRP3 was redistributed to the perinuclear space in cells infected with a lentivirus expressing the 3a protein KC efflux and mitochondrial reactive oxygen species were important for SARS CoV 3a induced NLRP3 inflammasome activation These results highlight the importance of viroporins transmembrane pore forming viral proteins in virus induced NLRP3 inflammasome activation Keywords SARS CoV viroporin inflammasome IL 1b inflammation INTRODUCTION Severe acute respiratory syndrome coronavirus SARS CoV a member of the genus Betacoronavirus within the family Coronaviridae is an enveloped virus with a single stranded positive sense RNA genome of approximately 30 kb in length The 50 two thirds of the genome encodes large polyprotein precursors open reading frame ORF 1 and ORF1b which are proteolytically cleaved to generate 16 non structural proteins Tan et al 2005 The 30 one third of the genome encodes four structural proteins spike S envelope E matrix M and nucleocapsid N and non structural proteins along with a set of accessory proteins 3a 3b 6 7a 7b 8a 8b and 9b Perlman and Dandekar 2005 Tan et al 2005 SARS CoV is the etiological agent of SARS Drosten et al 2003 Fouchier et al 2003 Ksiazek et al 2003 Kuiken et al 2003 Peiris et al 2003 At least 8 098 laboratory confirmed cases of human infection with a fatality rate of 9 6 were reported to the World Health Organization from November 2002 to July 2003 High levels Frontiers in Microbiology www frontiersin org 1 January 2019 Volume 10 Article 50 fmicb 10 00050 January 25 2019 Time 17 49 2 Chen et al Inflammasome Activation by SARS CoV 3a of proinflammatory cytokines including tumor necrosis factor TNF a interleukin IL 1b and IL 6 were detected in autopsy tissues from SARS patients He et al 2006 Although dysregulation of inflammatory cytokines may be involved in lung injury and the pathogenesis of SARS CoV the underlying molecular mechanisms are not fully understood The innate immune systems utilizes pattern recognition receptors PRRs to detect pathogen associated molecular patterns Medzhitov 2001 Kawai and Akira 2010 Recognition of virus infection plays an important role in limiting virus replication at the early stages of infection Nod like receptor family pyrin domain containing 3 NLRP3 is activated by a wide variety of stimuli including virus infection Bauernfeind et al 2011 Four models describing activation of the NLRP3 inflammasome have been proposed thus far Hornung and Latz 2010 Schroder et al 2010 Tschopp and Schroder 2010 First the disturbances in intracellular ionic concentrations including KC e ux and Ca2C influx play an important role Fernandes Alnemri et al 2007 Petrilli et al 2007 Arlehamn et al 2010 Ichinohe et al 2010 Ito et al 2012 Murakami et al 2012 Munoz Planillo et al 2013 Second cathepsin B and L which are specific lysosomal cysteine proteases are though to play a role after phagocytosis of cholesterol crystals Duewell et al 2010 fibrillar peptide amyloid beta Halle et al 2008 silica crystals and aluminum salts Hornung et al 2008 Third is the release of reactive oxygen species ROS or mitochondrial DNA from damaged mitochondria Zhou et al 2010 2011 Nakahira et al 2011 Shimada et al 2012 Finally viral RNA or RNA cleavage products generated by RNase L activate the NLRP3 inflammasome via the DExD H box helicase DHX33 Allen et al 2009 Mitoma et al 2013 Chen et al 2014 Chakrabarti et al 2015 Upon activation the NLRP3 is recruited to the mitochondria via association with mitochondrial antiviral signaling MAVS or mitofusin 2 expressed on the outer mitochondrial membrane Ichinohe et al 2013 Subramanian et al 2013 these molecules then recruit the apoptosis associated speck like protein containing a caspase recruitment domain ASC and pro caspase 1 to form the NLRP3 inflammasome This event activates the downstream molecule caspase 1 which catalyzes the proteolytic processing of pro IL 1b and pro IL 18 into their active forms and stimulates their secretion Kayagaki et al 2015 Shi et al 2015 It is increasingly evident that NLRP3 detects RNA viruses by sensing the cellular damage or distress induced by viroporins Ichinohe et al 2010 Ito et al 2012 Triantafilou et al 2013 Nieto Torres et al 2015 transmembrane pore forming proteins encoded by certain RNA viruses these proteins alter membrane permeability to ions by forming membrane channels Tan et al 2005 Chen and Ichinohe 2015 A recent study shows that the SARS CoV E protein which comprise only 76 amino acids forms Ca2C permeable ion channels and activates the NLRP3 inflammasome Nieto Torres et al 2015 Although the E and 3a proteins of SARS CoV which comprise 274 amino acids and contain three transmembrane domains Zeng et al 2004 Lu et al 2006 are thought to act as NaC KC and KC channels respectively Wilson et al 2004 Lu et al 2006 Torres et al 2007 Parthasarathy et al 2008 Pervushin et al 2009 Wang et al 2011 the role of the 3a protein in activating the NLRP3 inflammasome remains unknown Here we examined the role of the 3a protein in activating the NLRP3 inflammasome MATERIALS AND METHODS Mice Six week old female C57BL 6 mice were purchased from The Jackson Laboratory All animal experiments were approved by the Animal Committees of the Institute of Medical Science The University of Tokyo Cells and Viruses Bone marrow derived macrophages BMMs were prepared as described previously Ichinohe et al 2009 In brief bone marrow was obtained from the tibia and femur by flushing with Dulbecco s modified Eagle s medium DMEM Nacalai Tesque Bone marrow cells were cultured for 5 days in DMEM supplemented with 30 L929 cell supernatant containing macrophage colony stimulating factor 10 heat inactivated fetal bovine serum FBS and L glutamine 2 mM at 37 C 5 CO2 HEK293FT cells a human embryonic kidney cell line and HeLa cells a human epithelial carcinoma cell line were maintained in DMEM supplemented with 10 FBS penicillin 100 units ml and streptomycin 100 mg ml Nacalai Tesque MDCK cells Madin Darby canine kidney cells and HT 1080 cells a human fibrosarcoma cell line were grown in Eagle s minimal essential medium E MEM Nacalai Tesque supplemented with 10 FBS penicillin 100 units ml and streptomycin 100 mg ml Nacalai Tesque Influenza A virus strain A PR8 H1N1 was grown at 35 C for 2 days in the allantoic cavities of 10 day old fertile chicken eggs Ichinohe et al 2009 The viral titer was quantified in a standard plaque assay using MDCK cells Pang et al 2013 Plasmids cDNAs encoding the E and M proteins of SARS CoV Frankfurt 1 strain Matsuyama et al 2005 were obtained by reverse transcription and PCR of total RNA extracted from SARS CoV infected Vero cells followed by PCR amplification using specific primers pcDNA3 1D 3a V5His was provided by Ming Fu Chang National Taiwan University College of Medicine Taipei Taiwan To generate the plasmids pLenti6 E V5His pLenti6 3a V5His and pLenti M V5His cDNA fragments of E 3a and M were amplified from pcDNA3 1D E V5His pcDNA3 1D 3a V5His and pcDNA3 1D M V5His using specific primer sets and then ligated into pLenti6 TOPO vectors Invitrogen To generate plasmids pCA7 flag E pCA7 flag 3a and pCA7 flag M pCA7 HA E pCA7 HA 3a and pCA7 HA M cDNA fragments of E 3a and M were amplified from pcDNA3 1D E V5His pcDNA3 1D 3a V5His and pcDNA3 1D M V5His using specific primer sets digested with EcoR I and Not I and subcloned into the EcoR I Not I sites of the pCA7 flag ASC plasmid or pCA7 HA M2 plasmid respectively Ito et al 2012 To construct plasmids expressing the E mutant V25F the Frontiers in Microbiology www frontiersin org 2 January 2019 Volume 10 Article 50 fmicb 10 00050 January 25 2019 Time 17 49 3 Chen et al Inflammasome Activation by SARS CoV 3a FIGURE 1 The 3a protein of SARS CoV stimulates IL 1b secretion A C HEK293FT cells were transfected with pLenti6 E V5 pLenti6 3a V5 pLenti6 M V5 A pLenti GFP V5 B or pLenti M2 V5 plasmids C Samples were analyzed by immunoblot with mouse monoclonal antibodies against V5 tag A GFP B or influenza virus M2 C D E LPS primed BMM were infected with the lentivirus expressing SARS CoV E 3a M influenza virus M2 or EMCV 2B at MOI 0 25 D or 0 1 E Supernatants were collected at 24 h post infection and analyzed for IL 1b by ELISA Data are representative of at least three independent experiments and indicate the mean SD D E P 0 001 FIGURE 2 Ion channel activity of the 3a protein is required for IL 1b secretion A SARS CoV 3a protein below amino acid sequence of cysteine rich domain residue 127 133 of wild type 3a and 3a CS mutant B LPS primed BMM were infected with the lentivirus expressing SARS CoV E V25F 3a 3a CS or M at MOI 0 25 Supernatants were collected at 24 h post infection and analyzed for IL 1b by ELISA Data are representative of at least three independent experiments and indicate the mean SD B P 0 001 Frontiers in Microbiology www frontiersin org 3 January 2019 Volume 10 Article 50 fmicb 10 00050 January 25 2019 Time 17 49 4 Chen et al Inflammasome Activation by SARS CoV 3a mutated E fragments were amplified by inverse PCR with wild type E containing plasmids and specific primer sets The PCR products were cleaved by Dpn I ligated in a ligase and T4 kinase containing reaction and then transformed into DH5a competent cells TOYOBO To construct plasmids expressing the 3a mutant 3a CS fragments were amplified from wild type 3a containing plasmids using 3a specific primer sets and transformed as described above DNA Transfection and Western Blot Analysis HEK293FT cells were seeded in 24 well cluster plates and transfected with 1 mg pLenti6 E 3a M V5His pLenti GFP green fluorescent protein or pLenti M2 using polyethylenimine PEI Max At 24 h post transfection the cells were lysed with RIPA buffer 50 mM Tris HCl 1 NP 40 0 05 sodium dodecyl sulfate SDS 150 mM NaCl and 1 mM EDTA And the lysates were subjected to SDS polyacrylamide gel electrophoresis PAGE followed by electroblotting onto polyvinylidene difluoride PVDF membranes The membranes were incubated over night with mouse anti V5 tag R960 25 Invitrogen mouse anti influenza A virus M2 14C2 Abcam mouse anti GFP GF200 Nacalai Tesque or rabbit anti tubulin DM1A Santa Cruz antibodies followed by horseradish peroxide conjugated anti mouse IgG Jackson Immuno Research Laboratories or anti rabbit IgG Invitrogen After washing 3 times with washing buffer 0 05 Tween 20 PBS the membranes were exposed using Chemi Lumi One Super Nacalai Tesque and the chemiluminescent signals were captured by an ImageQuant LAS 4000 mini apparatus GE Healthcare Lentiviral Vectors To generate lentiviruses expressing V5 tagged SARS CoV E 3a and M proteins the full length cDNA encoding each viral protein was cloned into the pLenti6 3 V5 TOPO vector Invitrogen using the following primers SARS CoV E forward 50 caccatgtactcattcgtttcgga 30 and reverse 50 gaccagaagatcaggaactc 30 SARS CoV 3a forward 50 caccatggatttgtttatgagatt 30 and reverse 50 caaaggcacgctagtagtcg 30 SARS CoV M forward 50 caccatggcagacaacggtactat 30 and reverse 50 ctgtactagcaaagcaatat 30 Sub confluent monolayers of HEK293FT cells seeded in a collagen coated dish 10 cm in diameter were transfected with 3 mg of pLenti6 3 V5 TOPO vector expressing each viral protein or EGFP together with ViraPower Packaging Mix Invitrogen using Lipofectamine 2000 Invitrogen The supernatants containing lentiviruses were harvested and filtered through a 0 45 mm filter Millipore at 72 96 h post transfection Ito et al 2012 The lentiviral titer was then quantified using HT 1080 cells as described previously Ichinohe et al 2013 Virus Infection Bone marrow derived macrophages were plated at a density of 8 105 in 24 well plate and infected with A PR8 influenza virus or lentivirus at a multiplicity of infection MOI of 5 or 0 2 for 1 h respectively Then BMMs were stimulated with 1 mg ml of LPS and cultured for additional 23 h in complete media Supernatants were collected at 24 h post infection and centrifuged to remove cell debris The amount of IL 1b in the supernatants was measured in an enzyme linked immunosorbent assay ELISA using paired antibodies eBioscience Ichinohe et al 2010 2013 Confocal Microscopy To clarify the cellular localization of the wild type and mutant 3a proteins of SARS CoV HeLa cells were cultured on coverslips and transfected with 1 mg of pCA7 flag 3a or pCD7 flag 3a CS together with 0 5 mg of ER mCherry or DsRed Golgi Ito et al 2012 At 24 h post transfection cells were fixed with 4 paraformaldehyde and permeabilized with 1 Triton X 100 PBS After washing with PBS and blocking with 4 BSA PBS the cells were incubated with a mouse anti flag antibody M2 Sigma followed by incubation with Alexa Fluor 488 conjugated goat anti mouse IgG HCL Life Technologies To observe the cellular distribution of NLRP3 in the E or 3a expressing cells HeLa cells were cultured on coverslips and transfected with 1 mg of pCA7 HA E pCA7 HA EV25F pCA7 HA 3a pCA7 HA 3a CS or pCA7 control vector together with 0 5 mg of pCA7 NLRP3 At 24 h post transfection cells were fixed and permeabilized with 4 paraformaldehyde and 1 Triton X 100 PBS After washing and blocking the cells were incubated with rabbit anti HA 561 MBL and mouse anti NLRP3 Cryo 2 AdipoGen antibodies followed by Alexa Fluor 488 conjugated goat anti rabbit IgG HCL and Alexa Fluor 568 conjugated goat anti mouse IgG HCL Life Technologies Fluorescent signals were observed by confocal microscopy A1RC Nikon Statistical Analysis Statistical significance was tested using a two tailed Student s t test P values 0 05 were considered statistically significant RESULTS Viroporin 3a of SARS CoV Is Sufficient to Stimulate IL 1b Secretion We previously demonstrated that the influenza virus M2 protein a proton selective ion channel its H37G mutant which has lost its proton selectivity and enables the transport of other cations such as NaC and KC and the EMCV 2B protein a Ca2Cchannel stimulates NLRP3 inflammasome mediated IL 1b secretion Ichinohe et al 2010 Ito et al 2012 In addition the SARS CoV E protein acts as a Ca2C permeable ion channels that activates the NLRP3 inflammasome Nieto Torres et al 2015 The fact that 3a protein of SARS CoV acts as viroporin prompted us to examine whether it also triggers inflammasome activation Thus we first generated lentivirus plasmids expressing V5 tagged proteins and confirmed their expression in HEK293FT cells by immunoblot analysis Figures 1A C We next transduced lipopolysaccharide LPS primed BMMs with the lentiviruses expressing the SARS CoV E 3a M influenza virus M2 or EMCV 2B proteins Consistent with previous reports Ichinohe et al Frontiers in Microbiology www frontiersin org 4 January 2019 Volume 10 Article 50 fmicb 10 00050 January 25 2019 Time 17 49 5 Chen et al Inflammasome Activation by SARS CoV 3a FIGURE 3 Subcellular localization of SARS CoV 3a protein and 3a CS mutant A B HeLa cells were transfected with the expression plasmid encoding flag tagged 3a or 3a CS and that encoding either DsRed monomer Golgi A or ER mCherry B and observed with a confocal microscope at 24 h post transfection Scale bars 10 mm Data are representative of at least three independent experiments 2010 Ito et al 2012 IL 1b was released from LPS primed BMMs transduced with the M2 and 2B expressing lentivirus Figure 1D Similarly the lentiviruses expressing the SARS CoV E or 3a proteins stimulated IL 1b release from LPS primed BMMs Figure 1D Furthermore IL 1b secretion from LPS primed BMMs co infected with E and 3a expressing lentiviruses was significantly higher than that from SARS CoV E expressing lentivirus infected cells Figure 1E These data indicated that the expression of SARS CoV viroporin 3a is sufficient to stimulate IL 1b secretion by LPS primed BMMs The Ion Channel Activity of the 3a Protein Is Required for Inflammasome Mediated IL 1b Secretion Previous studies demonstrated that the N terminal 40 amino acids of the SARS CoV E protein are important for ion channel formation and that mutations N15A and V25F located in the transmembrane domain from amino acid residues 7 38 prevent ion conductivity Wilson et al 2004 Torres et al 2007 Verdia Baguena et al 2012 In addition the SARS CoV 3a protein contains a cysteine rich domain amino acid residues 127 133 that is involved in the formation of a homodimer to generate the ion channel Lu et al 2006 Chan et al 2009 Thus mutation of the cysteine rich domain blocks the ion conductivity by the 3a protein Chan et al 2009 To this end we substituted amino acids Cys 127 Cys 130 and Cys 133 within the cysteine rich domain of the SARS CoV 3a protein with serine to generate a lentivirus expressing the ion channel activity loss mutant 3a CS Chan et al 2009 Figure 2A To test whether the ion channel activity of the SARS CoV 3a protein is required to stimulate secretion of IL 1b we transduced LPS primed BMMs with lentiviruses expressing the SARS CoV E V25F 3a 3a CS or M proteins Consistent with a previous report Nieto Torres et al 2015 we found that the V25F mutant lentivirus failed to stimulate IL 1b release from BMMs Figure 2B Notably the 3a CS mutant completely abrogated IL 1b secretion Figure 2B suggesting that the ion channel activity of the 3a protein is required for SARS CoV 3a induced IL 1b secretion FIGURE 4 NLRP3 inflammasome activation by SARS CoV 3a HeLa cells were transfected with the expression plasmid encoding NLRP3 and that encoding HA tagged SARS CoV 3a 3a CS E or V25F and by with a confocal microscope Scale bars 10 mm Data are representative of at least three independent experiments SARS CoV 3a Is Sufficient to Trigger Activation of the NLRP3 Inflammasome Next we determined the subcellular localization of the SARS CoV 3a protein using confocal microscopy When the SARS CoV Frontiers in Microbiology www frontiersin org 5 January 2019 Volume 10 Article 50 fmicb 10 00050 January 25 2019 Time 17 49 6 Chen et al Inflammasome Activation