【病毒外文文獻(xiàn)】2004 Relative rates of non-pneumonic SARS coronavirus infection and SARS coronavirus pneumonia

《【病毒外文文獻(xiàn)】2004 Relative rates of non-pneumonic SARS coronavirus infection and SARS coronavirus pneumonia》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2004 Relative rates of non-pneumonic SARS coronavirus infection and SARS coronavirus pneumonia（5頁(yè)珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

For personal use Only reproduce with permission from The Lancet publishing Group ARTICLES THELANCET Vol 363 March 13 2004 841 Summary Background Although the genome of severe acute respiratory syndrome coronavirus SARS CoV has been sequenced and a possible animal reservoir identified seroprevalence studies and mass screening for detection of subclinical and non pneumonic infections are still lacking Methods We cloned and purified the nucleocapsid protein and spike polypeptide of SARS CoV and examined their immunogenicity with serum from patients with SARS CoV pneumonia An ELISA based on recombinant nucleocapsid protein for IgG detection was tested with serum from 149 healthy blood donors who donated 3 years previously and with serum positive for antibodies against SARS CoV by indirect immunofluorescence assay from 106 patients with SARS CoV pneumonia The seroprevalence of SARS CoV was studied with the ELISA in healthy blood donors who donated during the SARS outbreak in Hong Kong non pneumonic hospital inpatients and symptom free health care workers All positive samples were confirmed by two separate western blot assays with recombinant nucleocapsid protein and recombinant spike polypeptide FindingsWestern blot analysis showed that the nucleocapsid protein and spike polypeptide of SARS CoV are highly immunogenic The specificity of the IgG antibody test ELISA with positive samples confirmed by the two western blot assays was 100 and the sensitivity was 94 3 Three of 400 healthy blood donors who donated during the SARS outbreak and one of 131 non pneumonic paediatric inpatients were positive for IgG antibodies confirmed by the two western blot assays total 0 48 of our study population Interpretation Our findings support the existence of subclinical or non pneumonic SARS CoV infections Such infections are more common than SARS CoV pneumonia in our locality Lancet 2004 363 841 45 Introduction Severe acute respiratory syndrome SARS has now affected 30 countries in five continents with more than 8400 cases and more than 910 deaths A novel virus the SARS coronavirus SARS CoV is known to be the aetiological agent 1 9 The viral genome has been completely sequenced 10 11 We have also reported the isolation of viruses resembling SARS CoV from Himalayan palm civets found in a live animal market in the Guangdong Province of China this finding implied that animals could be a reservoir of the virus 12 Detection of SARS CoV from a non pneumonic case in Singapore http www who int csr don 2003 09 16 en suggested that non pneumonic and subclinical SARS CoV infections are possible However extensive seroprevalence studies and mass screening for detection of subclinical and non pneumonic infections are still lacking At present the most widely used methods for detection of antibodies against SARS CoV are indirect immuno fluorescence assay and ELISA with cell culture extract 1 5 However antibody detection by these methods is difficult to standardise and has not been compared with recombinant antigen based antibody detection tests A recent seroprevalence study which used the indirect immunofluorescence assay for antibody detection did not detect SARS CoV antibodies in any of 674 health care workers from a hospital in which a SARS outbreak had occurred 13 An approach of ELISA based antibody detection tests using recombinant antigens with positive results confirmed by western blot assays that use two different antigenic proteins offers higher sensitivity specificity and reproducibility than indirect immunofluorescence assay and ELISA with cell culture extract and is easier to standardise 14 19 In this study we used a sensitive and specific ELISA based on the highly immunogenic nucleocapsid protein of SARS CoV and confirmed positive results by western blot assays with recombinant nucleocapsid protein and recombinant spike polypeptide another highly immunogenic protein of SARS CoV to examine the seroprevalence of non pneumonic SARS CoV in the general population non pneumonic patients in hospital and health care workers during the SARS epidemic Methods RNA extraction Coronavirus isolated from a patient with SARS CoV pneumonia in Hong Kong was inoculated into Vero cells at confluence in Dulbecco s modified Eagle s medium Gibco BRL Carlsbad CA USA with 10 fetal calf serum in a tissue culture flask After 48 h the supernatant was transferred to a new tube and centrifuged at 12000 g for 15 min at 4 C Viral RNA was extracted from 100 H9262L of the supernatant with TRIzol reagent Gibco BRL according to the manufacturer s instructions The RNA Relative rates of non pneumonic SARS coronavirus infection and SARS coronavirus pneumonia Patrick C Y Woo Susanna K P Lau Hoi wah Tsoi Kwok hung Chan Beatrice H L Wong Xiao yan Che Victoria K P Tam Sidney C F Tam Vincent C C Cheng Ivan F N Hung Samson S Y Wong Bo jian Zheng Yi Guan Kwok yung Yuen Department of Microbiology University of Hong Kong University Pathology Building Queen Mary Hospital Hong Kong P C Y Woo MD S K P Lau MRCP H W Tsoi MPhil K H Chan PhD B H L Wong MMedSc V K P Tam MB V C C Cheng MRCP I F N Hung MRCP S S Y Wong MRCPath B J Zheng PhD Y Guan PhD Prof K Y Yuen FRCPath Central Laboratory Zhujiang Hospital First Military Medical University Guangzhou China X Y Che MD and Department of Clinical Biochemistry Queen Mary Hospital Hong Kong S C F Tam FRCPA Correspondence to Prof Kwok yung Yuen e mail kyyuen hkucc hku hk For personal use Only reproduce with permission from The Lancet publishing Group pellet was resuspended in 10 H9262L DNase free RNase free double distilled water and was used as the template for RT PCR Cloning and purification of His 6 tagged recombinant proteins To produce a fusion plasmid of the nucleocapsid protein of the SARS CoV for protein purification primers LPW723 and LPW726 panel were used to amplify the gene encoding this protein by RT PCR The sequence coding for aminoacid residues 1 422 of the nucleocapsid protein was amplified and cloned into the BamHI and EcoRI sites of expression vector pET 28b Novagen Madison WI USA in frame and downstream of the series of six histidine residues The His 6 tagged recombinant nucleocapsid protein was expressed and purified by means of the nickel loaded HiTrap Chelating System Amersham Pharmacia Piscataway NJ USA according to the manufacturer s instructions Roughly 3 mg purified protein was routinely obtained from 1 L Escherichia coli carrying the fusion plasmid For the spike protein of the SARS CoV primers LPW742 and LPW931 panel were used to amplify the gene encoding aminoacid residues 14 667 by RT PCR This portion of the spike protein was used because the complete protein could not be expressed in E coli The PCR product was cloned into the BamHI and KpnI sites of vector pQE 31 Qiagen Hilden Germany The resulting clone was digested by PstI and the fragment that contained the gene encoding aminoacid residues 250 667 of the spike protein was cloned into expression vector pQE 30 Qiagen Hilden Germany in frame and downstream of the series of six histidine residues Expression and purification of the His 6 tagged recombinant spike polypeptide were done as described for the nucleocapsid protein Western blot analysis Western blot analysis was done according to our published protocols with slight modifications 20 22 Briefly 200 ng purified His 6 tagged recombinant nucleocapsid protein or His 6 tagged recombinant spike polypeptide was loaded into each well of a sodium dodecyl sulphate 10 polyacrylamide gel then electroblotted onto a nitrocellulose membrane Bio Rad Hercules CA USA The blot was cut into strips and the strips were incubated separately with 1 in 1000 dilution of three serum samples obtained from three patients with SARS CoV pneumonia positive for antibodies against SARS CoV detected by our indirect immunofluorescence assay 1 Antigen antibody interaction was detected with an ECL fluorescence system Amersham Life Science Buckinghamshire UK Serum samples from three healthy blood donors were used as controls Assessment of recombinant nucleocapsid protein ELISA Serum samples from 149 healthy blood donors who donated blood 3 years previously aged 18 years or older and 106 patients with pneumonia positive for antibodies against SARS CoV detected by our indirect immuno fluorescence assay 1 were used for the assessment of the ELISA based IgG antibody test The test was modified from our previous publications 15 17 Briefly each well of a Nunc immunoplate Roskilde Denmark was coated with 20 ng purified His 6 tagged recombinant nucleocapsid protein for 12 h then blocked in phosphate buffered saline with 2 bovine serum albumin 100 H9262L diluted human serum 1 in 40 was added to each well of the protein coated plates and they were incubated at 37 C for 2 h After five washes with washing buffer 100 H9262L horseradish peroxidase conjugated goat antibody to human IgG 1 in 4000 dilution Zymed Laboratories Inc South San Francisco CA USA was added to each well and the plates were incubated at 37 C for 1 h After a further five washes with washing buffer 100 H9262L diluted ARTICLES 842 THELANCET Vol 363 March 13 2004 Primer sequences Nucleocapsid protein LPW723 5H11032 CGCGGATCCGATGTCTGATAATGGACC 3H11032 LPW726 5H11032 CGGAATTCTTATGCCTGCCTGAGTTGAATC 3H11032 Spike protein LPW742 5H11032 CGCGGATCCGAGTGACCTTGACCGGTGC 3H11032 LPW931 5H11032 CGGGGTACCTTAACGTAATAAAGAAACTGTATG 3H11032 50 kDa 12 Nucleocapsid protein Spike polypeptide 3456 50 kDa 123456 Figure 1 Western blot analysis of purified recombinant SARS CoV nucleocapsid protein and purified recombinant SARS CoV spike polypeptide Prominent immunoreactive protein bands of about 50 kDa were visible for both antigens with serum from three patients with SARS CoV pneumonia indicating antigen antibody interactions between the recombinant SARS CoV nucleocapsid protein and the patients antibodies lanes 1 3 No immunoreactive band was detected for serum from three healthy blood donors lanes 4 6 For personal use Only reproduce with permission from The Lancet publishing Group 3 3H11032 5 5H11032 tetramethylbenzidine Zymed Laboratories was added to each well and incubated at room temperature for 15 min 100 H9262L 0 3 mol L sulphuric acid was added and the absorbance at 450 nm of each well was measured Each sample was tested in duplicate and the mean absorbance for each sample was calculated The presence of specific antibodies in positive samples was confirmed by retesting of the sample by the ELISA based on recombinant nucleocapsid protein and western blot assays with recombinant nucleocapsid protein and recombinant spike polypeptide separately Seroprevalence of SARS CoV Using the protocol described above we tested for the presence of IgG antibodies against the nucleocapsid protein in serum samples from 400 healthy blood donors aged 18 years or older who donated blood in March May 2003 131 non pneumonic paediatric inpatients aged less than 18 years and 264 non pneumonic adult inpatients aged 18 years or older admitted to Queen Mary Hospital in May 2003 and 33 symptom free health care workers The presence of specific antibodies in all positive samples was confirmed by two separate western blot assays one with recombinant nucleocapsid protein and the other with recombinant spike polypeptide as the antigen Role of the funding source The study sponsors had no role in the study design collection analysis or interpretation of data or the writing of the report Results The purified His 6 tagged recombinant nucleocapsid protein and spike polypeptide were separated on denaturing polyacrylamide gels followed by western blot analysis with serum from three patients with pneumonia positive for antibodies against the SARS CoV Prominent immunoreactive protein bands of about 50 kDa were visible on the western blots that used either antigen figure 1 These sizes were consistent with the expected size of 49 6 kDa for the full length His 6 tagged nucleocapsid protein and 48 6 kDa for the His 6 tagged spike polypeptide An ELISA based SARS CoV antibody test was developed for the detection of specific antibodies against the His 6 tagged recombinant nucleocapsid protein Box titration was carried out with different dilutions of His 6 tagged recombinant nucleocapsid protein coating antigen and pooled serum from three patients with pneumonia positive for antibody against the SARS CoV The results identified 20 ng purified His 6 tagged recombinant nucleocapsid protein per ELISA well as the ideal amount for plate coating for IgG detection data not shown To establish the baseline for the tests serum samples from 149 healthy blood donors who donated blood 3 years previously were tested in the ELISA For these samples the mean optical density at 450 nm for IgG detection was 0 127 SD 0 068 An absorbance value of 0 263 was selected as the cut off value the mean value for the healthy controls plus 2 SD figure 2 Seven of the samples from 149 healthy blood donors had values of more than 0 263 in the IgG ELISA figure 2 but none of them had the specific antibody when tested by the nucleocapsid protein or the spike polypeptide western blot assay The specificity of the IgG antibody test ELISA confirmed by western blot assays was 100 The mean value for the samples obtained from the 106 patients with SARS CoV pneumonia positive for IgG antibodies against the SARS CoV by our indirect immunofluorescence assay was 1 153 SD 0 702 100samples had optical density of more than 0 263 in the ARTICLES THELANCET Vol 363 March 13 2004 843 Optical densilty at 450 nm Healthy blood donors in 2000 n 149 Patients with SARS CoV pneumonia n 106 Healthy blood donors in March May 2003 n 400 Non pneumonic paediatric patients n 131 Non pneumonic adult patients n 264 Symptom free health care workers n 33 3 500 3 000 2 500 2 000 1 500 1 000 0 500 0 263 0 Figure 2 ELISA based on recombinant nucleocapsid protein IgG antibody for SARS CoV infection For personal use Only reproduce with permission from The Lancet publishing Group IgG ELISA figure 2 All 100 were confirmed to have the specific antibody by both the nucleocapsid protein and the spike polypeptide western blot assays The sensitivity of the IgG antibody test with the immunofluorescence assay as the gold standard was therefore 94 3 16 4 0 of the 400 healthy blood donors who donated blood in March May 2003 eight 6 1 of the 131 non pneumonic paediatric patients eight 3 0 of the 264 non pneumonic adult patients and one 3 of the 33 symptom free health care workers who had cared for the patients with SARS CoV pneumonia were positive for IgG antibodies by ELISA figure 2 However only three 0 8 healthy blood donors who donated blood in March May 2003 and one 0 8 non pneumonic paediatric patient were confirmed to have specific SARS CoV antibodies by both the nucleocapsid protein and spike polypeptide western blot assays Up to the end of May 1728 patients from a population of about seven million in Hong Kong 0 025 had developed SARS CoV pneumonia compared with a rate of non pneumonic SARS CoV infections in our study population of about 0 48 p 0 001 by Poisson exact test of equality Discussion Previous studies in animal coronaviruses such as infectious bronchitis virus have shown that the nucleocapsid protein and spike protein are highly immunogenic are abundantly expressed during infection and can be used for serodiagnosis of animal coronavirus infections 23 25 In this study detection of IgG antibodies to both proteins was highly sensitive and specific for SARS CoV infections Six 5 7 serum samples that were seropositive by the immunofluorescence assay were negative by the ELISA The reason for this discrepancy may be that the nucleocapsid protein did not elicit antibody response in this minority group of patients Conversely of five patients with SARS CoV pneumonia who were seronegative by the immunofluorescence assay but RT PCR positive for SARS CoV two were seropositive by our ELISA with clearly positive optical density values of 0 874 and 1 228 and confirmation by western blot assay unpublished Furthermore in four of 20 patients with SARS coronavirus pneumonia who had serial serum samples IgG was detected earlier by the ELISA than by the immunofluorescence test unpublished In another study that used ELISA based on cell culture extract five of 15 patients with SARS CoV pneumonia were positive according to that ELISA but negative by indirect immunofluorescence during the time when the ELISA titres were low 5 This finding accords with the results of a previous study on human coronavirus 229E which showed that three of 51 serum samples were positive by recombinant nucleocapsid protein based western blot but negative by immunofluorescence and six of 51 serum samples were positive by immunofluorescence but negative by recombinant nucleocapsid protein based western blot 26 All these findings show that our ELISA may be able to detect additional cases that the immuno fluorescence assay has missed With this potentially more sensitive ELISA for IgG antibody detection we assessed the seroprevalence of non pneumonic SARS CoV infections in both the general population and our hospital population all positive serum samples detected by ELISA were confirmed by two separate western blot assays with two immunologically unrelated antigens The spike polypeptide was used in addition to the nucleocapsid protein for western blot confirmation to eliminate the possibility of cross reactivity between antibodies against the nucleocapsid proteins of other human coronaviruses and that of SARS CoV However the aminoacid identities between the nucleocapsid protein of SARS CoV and those of the human coronaviruses OC43 and 229E are only 32 7 and 21 3 respectively and there were no cross reactions between 13 pairs of OC43 and 14 pairs of 229E human coronavirus serum samples and the SARS CoV 5 In fact of the 33 individuals who were IgG positive by ELISA 26 79 were positive by the nucleocapsid protein based western blot assay but only four were positive by both the nucleocapsid protein and the spike polypeptide western blot assays This apparent high rate of false positive non pneumonic cases as detected by the recombinant nucleocapsid protein ELISA is due to the use of a single antigen for screening asymptomatic or non pneumonic infections It is well known that the positive predictive values of serological tests are much affected when the prevalence of the infection is low especially in clinically incompatible cases This is the reason why an immunologically unrelated antigen the spike protein has to be used for confirmation of the cases detected as positive by the nucleocapsid protein based assays Cross reactivity with human coronavirus OC43 or other SARS CoV like viruses remains an important issue for future studies on SARS CoV serology Three of the four individuals with non pneumonic SARS CoV infections were healthy blood donors and one was a paediatric inpatient This patient was a 19 month old girl who was admitted to hospital in May 2003 because of fever for 2 days She was also noted to have had a cough for the previous 2 weeks and repeated vomiting before admission There had been no breathing difficulty or diarrhoea The child had no history of direct contact with patients with SARS CoV pneumonia However a colleague in her mother s workplace had recently been diagnosed as having SARS CoV pneumonia Physical examination of the girl revealed only shotty palpable but too small to be measured cervical lymph nodes and congested throat Her chest radiograph was normal Apart from mild lymphopenia lymphocyte count 0 63H1100310 9 L her blood results were normal Nasopharyngeal aspirate was negative for influenza viruses parainfluenza viruses adenovirus and respiratory syncytial virus antigens 27 She was given antipyretic treatment and was discharged the next day Subsequent antibody testing showed that her serum was positive for both IgG and IgM antibodies against the nucleocapsid protein as