【病毒外文文獻】2006 Colonization of Severe Acute Respiratory Syndrome-Associated Coronavirus Among Health-Care Workers Screened by Naso

《【病毒外文文獻】2006 Colonization of Severe Acute Respiratory Syndrome-Associated Coronavirus Among Health-Care Workers Screened by Naso》由會員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻】2006 Colonization of Severe Acute Respiratory Syndrome-Associated Coronavirus Among Health-Care Workers Screened by Naso（7頁珍藏版）》請在裝配圖網(wǎng)上搜索。

Colonization of Severe Acute Respiratory Syndrome Associated Coronavirus Among Health Care Workers Screened by Nasopharyngeal Swab Hsin Tsung Ho MD PhD Mau Sun Chang PhD Tsai Yin Wei MS Wen Shyang Hsieh MS Chia Chien Hung MS Huei Mei Yang BS and Yen Ta Lu MD PhD Study objectives To report the efficacy and findings of a large scale preventive screening program for severe acute respiratory syndrome associated coronavirus SARS CoV using amplification of the virus from a nasopharyngeal swab NPS obtained from the health care workers HCWs Design A prospective observational study Setting A medical center in Taiwan Participants Two hundred thirty HCWs Intervention NPS examination for the presence of SARS CoV by two nested reverse transcription polymerase chain reaction RT PCR assays Measurements and results During the outbreak of severe acute respiratory syndrome SARS NPS polymerase chain reaction screening of HCWs for SARS CoV was performed SARS CoV was examined by two nested RT PCRs and a quantitative RT PCR Serum specific antibodies were assessed by enzyme immunoassay and indirect immunofluorescence We monitored 230 HCWs including 217 first line HCWs and 13 non first line HCWs One hundred ninety first line HCWs and 13 non first line HCWs had negative results in both nested RT PCR assays Two first line HCWs who were positive on both nested RT PCR assays had SARS They had 16 900 H115507 920 copies mean H11550SD of RNA per milliliter in the NPS and had detectable anti SARS antibodies The remaining 25 first line HCWs were negative for the first nested RT PCR but positive for the second nested RT PCR Their corresponding titers were 338 H11550227 copies of RNA per milliliter antibodies developed in none of these 25 HCWs The expression and function of angiotensin converting enzyme 2 were not different among these HCWs This study shows that colonization of SARS CoV occurred in 25 of 217 well protected first line HCWs on a SARS associated service but they remained seronegative Conclusion With the second RT PCR assay more sensitive than the first RT PCR assay we are able to show that approximately 11 5 of well protected HCWs exposed to SARS patients or specimens may have colonization without seroconversion Only those with significant clinical symptoms or disease would have active immunity Thus regular NPS screening for nested RT PCR assays in conjunction with a daily recording of body temperature in all first line HCWs may provide an effective way of early detection CHEST 2006 129 95 101 Key words immunology infection nosocomial infection viral disease Abbreviations ACEH11005angiotensin converting enzyme bpH11005base pair EIAH11005enzyme immunoassay HCWH11005health care worker IIFTH11005indirect immunofluorescence test NPSH11005nasopharyngeal swab PBMCH11005peripheral blood mononuclear cell RT PCRH11005reverse transcription polymerase chain reaction SARSH11005severe acute respiratory syndrome SARS CoVH11005severe acute respiratory syndrome associated coronavirus I t has been reported that as many as 21 of a total of 8 098 patients worldwide confirmed to have probable severe acute respiratory syndrome SARS from November 2002 to July 2003 were health care workers HCWs 1 The nosocomial spread of the virus in large hospitals was the major epidemic feature of early SARS outbreaks causing high mor bidity and mortality among HCWs 2 A convincing CHEST Original Research RESPIRATORY INFECTION www chestjournal org CHEST 129 1 JANUARY 2006 95 transmission route of this emerging disease remains to be determined but it is believed that the illness was mainly transmitted by close contact with con taminated droplets Despite the World Health Or ganization recommendation that all HCWs should use personal protective equipment 3 it was later For editorial comment see page 12 shown that clusters of cases still occurred among protected HCWs 4 Subclinical infection among some HCWs who might harbor the virus but in undetect able levels have been suggested although as yet unproven as a possible means of transmission 5 6 Understanding how SARS can be spread is impera tive since enforcing the early isolation and stringent protection of potential SARS cases would greatly aid the prevention of in hospital transmission To pre vent nosocomial spread of SARS additional preven tive measurements were implemented for the first line HCWs in Mackay Memorial Hospital including centralized accommodation for off duty HCWs and the early detection of SARS associated coronavirus SARS CoV by performing nasopharyngeal swab NPS and reverse transcription polymerase chain reaction RT PCR testing The aim of this prospec tive study was to report the efficacy of NPS screen ing for detection of subclinical infections Materials and Methods NPS Screening of HCWs The study was approved by the hospital institutional review board and informed consent was obtained from all participants The Mackay Memorial Hospital in Taiwan is a 2 000 bed teach ing hospital that employs 4 500 physicians nurses allied health professionals and clerical staff members Between April 27 and June 16 2003 there were 96 suspected SARS patients and 71 probable SARS patients treated in our hospital During this period we monitored 230 HCWs including 217 first line HCWs and 13 non first line HCWs The first line HCWs were those with close contact with SARS patients including medical staff in the emergency department SARS ward respiratory care units and personnel who manage laboratory specimens from SARS patients Other employees were classified as non first line HCWs if they had no contact history with SARS patients or specimens this included housekeeping staff and transporting personnel The first line HCWs attending to patients with sus pected or probable SARS were required to wear gloves gowns goggles and N 95 masks All participants were required to complete questionnaires describing their workplace contact his tory with SARS patients or specimens and symptoms experi enced during the study period Mild symptoms are defined as clinical symptoms that do not require medical treatment or can be treated with over the counter medications Since the titer of SARS CoV was noticed to increase in nasopharyngeal aspirates of patients between day 5 and day 10 as reported by Peiris et al 7 we decided to perform NPS screening of the first line HCWs at the end of 1 week of SARS associated service The subjects with initially positive NPS results were required to stay isolated in the centralized dormitory until the repeat sampling results became negative and or the subject had no fever for 3 days The first serum sample was drawn at the 30 to 48 day interval and the second sample was collected at the 64 to 78 day interval after the NPS was obtained Baseline samples had been drawn from HCWs for the serologic test before their SARS associated ser vice Anonymous processing of samples was performed to pre serve the confidentiality of the HCWs The critical laboratory information was only reported to the superintendents of medical technicians nurses and physicians Nested RT PCR Assays Specific for SARS CoV Each NPS specimen was collected in 2 mL of reagent Trizol Invitrogen Carlsbad CA and total RNAs were extracted ac cording to the instructions of the manufacturer GIBCO BRL Grand Island NY The extracted viral RNA of each specimen was resuspended in 100 H9262L of ribonuclease free water The RNA was reversely transcribed with random hexamers Abgene UK and reactions contained 12 5 H9262Lof2H11003 buffer concentrate 3 6 mmol L of magnesium sulfate 0 5 H9262L of each primer 0 5 H9262Lof reverse transcriptase Taq DNA polymerase mixture and 5 H9262L of RNA in a total volume of 25 H9262L The complementary DNA of every specimen was subjected to both the first and second nested RT PCR assays The first nested RT PCR assay used the primer pairs IN 6 IN 7 and Cor p F2 Cor p R1 Within the open read ing frame 1b of the coronavirus polymerase gene the 440 base pair bp segment was amplified with a broadly reactive genus specific primer pair IN 6 H11001 5H11032GGTTGGGACTATC CTAAGTGTGA3H11032 and IN 7 H11002 5H11032CCATCATCAGATAGAAT CATCATA3H11032 The complementary DNA was further amplified with a SARS specific primer pair Cor p F2 H11001 5H11032CTAACAT GCTTAGGATAATGG3H11032 and Cor p R1 H11002 5H11032CAGGTAAGCG TAAAACTCATC3H11032 The size of the first nested RT PCR product was 368 bp lane 2 Fig 1 Similarly a duplicate aliquot of complementary DNA for each specimen was also amplified with the second nested RT PCR using the sets of primers Cor p F2 Cor p R1 and then Cor p F3 Cor p R2 The Cor p F3 H11001 5H11032GCCTCTCTTGTTCTTGCTCGC3H11032 and Cor p R2 H11002 5H11032CCTATTTCTATAGAGACACTC3H11032 were another pair of SARS specific primers The size of the second nested RT PCR product was 306 bp lane 4 Fig 1 Positive and negative RT PCR controls were included in each run The specificity of nested RT PCR was confirmed by sequencing the positive amplified products obtained through agarose gel electrophoretic separation and compared with the reference sequence of SARS CoV 8 Thermocycling of reaction mixtures was completed in a thermo cycler model 2400 Perkin Elmer Applied Biosystems pro From the Department of Laboratory Medicine the Department of Medical Research and the Division of Chest Medicine Department of Internal Medicine Mackay Memorial Hospital and Department of Respiratory Care Taipei Medical University and Mackay Medicine Nursing and Management College Tai pei Taiwan This study was supported by the Taiwan National Science Council Grant NSC92 2751 B 195 001 Y and the National SARS Research Program SCLI01 Manuscript received March 24 2005 revision accepted July 11 2005 Reproduction of this article is prohibited without written permission from the American College of Chest Physicians www chestjournal org misc reprints shtml Correspondence to Yen Ta Lu MD PhD Division of Chest Medicine Department of Internal Medicine Mackay Memorial Hospital 92 Sec 2 Chung Shan North Rd Taipei 10449 Taiwan e mail ytlhl ms2 mmh org tw 96 Original Research grammed for 40 cycles 30 s at 95 C 30 s at 55 C and 45 s at 72 C followed by a 7 min incubation at 72 C Quantitative RT PCR Assay Specific for SARS CoV A duplicate aliquot of extracted RNAs from each NPS speci men was also subjected to the quantitative RT PCR assay The quantitative RT PCR was established 9 10 with SARS specific primers and 5H11032 nuclease probe Assays on Demand Gene Ex pression Products Applied Biosystems Foster City CA The 381 bp target fragment of SARS CoV RNA was transcribed and amplified ABI PRISM 7700 sequence detection system Applied Biosystems Plasmids a gift from the Center for Disease Control of Taiwan were used with the target sequence to generate the standard curve Quantification of messenger RNA was performed in a total volume of 25 H9262L TaqMan one step RT PCR Master Mix Reagent Applied Biosystems The reaction mixtures were reverse transcribed at 48 C for 30 min followed by 1 cycle of 95 C for 10 min and then amplified by 45 cycles of 95 C for 15 s and 60 C for 1 min Real time fluorescence measurements were obtained and a cycle threshold value for each sample was calculated by determining the point at which the fluorescence exceeded a threshold limit A standard curve of the cycle threshold values obtained from the serial dilutions of the standard was compiled The coefficient of linear regression and the slope for each standard curve were calculated The cycle threshold values from samples were plotted on the standard curve for calculating the number of genomes Serologic Tests for SARS CoV Specific IgG and IgM Serum samples were stored at H11002 70 C and subsequently tested for Igs for SARS CoV by using enzyme immunoassay EIA The wells of microtiter plate General Biologicals Corporation Hsin chu Taiwan were coated with the purified recombinant gluta thione S transferase nucleocapsid protein 11 Using the antigen antibody antigen sandwich technique a recombinant glutathione S transferase nucleocapsid protein horseradish peroxidase conju gate was performed for the detection of antibodies Serum samples from hospitalized patients with SARS and from unex posed laboratory personnel were included as positive and nega tive control samples respectively All the serum samples were further confirmed by use of an indirect immunofluorescence test IIFT for IgG or IgM specific for SARS CoV The test utilized BIOCHIP slides Euroimmun Berlin Germany containing SARS CoV infected cells and non infected cells positioned side by side in each reaction field The presence of serum antibodies were detected by the addition of fluorescein labeled goat anti human IgG or IgM conjugates Anti SARS CoV positive and anti SARS CoV negative control samples were simultaneously performed The results were read by an experienced medical technician under the fluorescence microscope The presence of fluorescence with 10 H11003 dilution of serum was considered positive Western Blot Analysis of Angiotensin Converting Enzyme 2 To determine whether inherited differences of the SARS CoV spike protein receptor angiotensin converting enzyme ACE 2 exist among HCWs the expression of ACE 2 in peripheral blood mononuclear cells PBMCs were examined by Western immu noblotting Peripheral blood was obtained with ethylenediamine tetra acetic acid and platelet rich plasma was removed after centrifugation at 1 500 revolutions per minute for 10 min The remainder of blood was then mixed with 3 mL of phosphate buffered saline solution overlaid on Ficoll Paque Plus Amer sham Pharmacia Biotech NY and centrifuged at 1 500 revolu tions per min for 30 min Mononuclear cells were isolated from the interface and washed twice with phosphate buffered saline solution To examine the effect of fever on the expression of ACE 2 total PBMCs were equally divided and separately cul tured at 37 C and 40 C for 24 h Cells were then lysed in radioimmunoprecipitation buffer with 50 mmol L Tris HCl 150 mmol L NaCl 1 Triton X 100 1 sodium deoxycholate 0 1 sodium dodecylsulfate protease inhibitor cocktails Roche Ger many The protein lysate was centrifuged at 13 500 revolutions min for 10 min at 4 C and supernatants were collected and kept at H11002 20 C Protein concentrations were determined by assay Bio Rad Dc protein assay kit Bio Rad Hercules CA Thirty micrograms of the total protein were added in sample buffer and boiled for 5 min Protein lysates were then resolved by 7 5 sodium dodecylsulfate polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membrane After blocking with 5 dry skimmed milk in Tris buffered saline solution with 0 05 Tween 20 at room temperature for 1 h membranes were probed with ACE 2 antibodies R Minneapolis MN at 4 C overnight Membranes were then incubated with secondary alkaline phosphatase conjugated goat anti mouse or rabbit IgG at room temperature for 1 h After washing with Tris buffered saline solution with 0 1 Tween 20 protein bands were visual ized CDP star Roche according to the instructions of the manufacturer ACE 2 Binding Assay by Flow Cytometry Purified PBMCs were harvested and washed twice with fluores cence activated cell sorter staining washing buffer A total of 2 to 5H1100310 5 cells were incubated with 1 H9262g of recombinant spike 1 2 3 Fc protein a gift from Dr Shie Liang Hsieh Yang Ming Univer sity Taiwan or hIgG1 as isotypic control for 30 min at 4 C Cells were washed twice and stained with the retinal pigment epithelium Figure 1 Two nested RT PCR tests designed for the detection of SARS CoV in NPSs Lane 1 and lane 3 negative control samples lane 2 and lane 4 NPS specimens Primer pairs are IN6 IN7 and F2 R1 used in lane 1 and lane 2 and F2 R1 and F3 R2 used in lane 3 and lane 4 M indicates 50 bp DNA ladder www chestjournal org CHEST 129 1 JANUARY 2006 97 conjugated anti human Ig antibodies for 30 min at 4 C After washing cells were fixed with fixation buffer for 30 min at 4 C finally the fluorescence was detected by fluorescence activated cell sorter Calibur ACE 2 binding assays were also performed for PBMCs incubated at 37 C and 40 C for 24 h Results Detection of SARS CoV in HCWs All 230 HCWs were ethnic Taiwanese The male to female ratio was 1 to 11 The mean age was 32 H11006 8 years H11006 SD Thirty eight of 203 RT PCR negative HCWs 18 7 and 2 of 27 RT PCR positive HCWs 7 4 had underlying diseases Ta ble 1 Among 230 HCWs 203 HCWs including 13 non first line HCWs showed negative results for both nested RT PCR assays Table 2 Two HCWs presented persistent fever H11022 38 5 C and subse quently acquired clinical SARS They were found to have positive results for both nested RT PCR tests with 16 900 H11006 7 920 copies of RNA per milliliter in the NPS and they acquired SARS CoV specific antibodies The remaining 25 HCWs were negative for the first nested RT PCR test but positive for the second nested RT PCR test Quantitative RT PCR tests showed significantly lower titers of viral RNA in the asymptomatic HCWs 312 H11006 204 copies per milliliter or mildly symptomatic HCWs 386 H11006 203 copies per milliliter as compared to those of two HCWs with SARS disease 16 900 H11006 7 920 copies per milliliter p H11021 0 01 Six of these 25 HCWs presented with mild symptoms including 2 HCWs with mild fever body temperature H11022 37 C to H11021 38 C 5 HCWs with cough and 1 HCW with diarrhea Regardless of asymptomatic or mildly symptomatic status their NPS titers of SARS CoV were not significantly different and none had anti bodies developing against SARS CoV However 22 of 203 RT PCR negative HCWs also had mild symp toms including 18 HCWs with sore throat or runny nose 6 with mild fever 12 with cough and 3 with diarrhea To detect the possibility of contamination in the nested RT PCR procedure positive and negative RT PCR control samples were included in each run The negative results of the first and second nested RT PCR tests presented by all of 13 non first line HCWs who had no contact history with SARS also support the absence of false positivity Table 2 To confirm the specificity of nested RT PCR the posi tive amplified products obtained through agarose gel electrophoretic separation was sequenced and 100 homology was noted as compared with the reference sequence of SARS CoV reported by Rota et al 8 The sets of primers of the second nested RT PCR F2 R1 and F3 R2 were more SARS specific than IN 6 IN 7 and F2 R1 used in the first nested RT PCR The corresponding quantitative RT PCR results were in concordance with a higher sensitivity of the second nested RT PCR test Serologic Tests With the appropriate convalescent serum samples collected and tested all of 203 HCWs with negative RT PCR findings had no detectable IgG or IgM antibodies against SARS CoV Two HCWs with SARS disease had detectable antibodies of IgG and IgM classes in their convalescent serum In spite of positive results by the second nested RT PCR and low titers of SARS CoV by quantitative RT PCR the remaining 25 HCWs had no detectable SARS CoV specific antibodies by either EIA or IIFT Table 3 ACE 2 Expression and Function Although 27 HCWs were found to have at least one positive nested RT PCR result for SARS CoV in their NPS only 2 HCWs with high titers of viral load and persistent fever acquired SARS disease The above observation that higher titers of virus may preferentially increase the likelihood of developing disease raises the possibility of inherited differences in the ACE 2 expression and function among those subjects Another possibility that ACE 2 might be inducible by febrile condition was studied by West ern immunoblotting and flow cytometry examination of PBMCs at different temperatures As Figure 2 shows ACE 2 expression of PBMCs was similar among all subjects either at 37 C or 40 C A func tional study by a binding assay showed that PBMCs did not bind the recombinant spike 1 2 3 Fc pro tein even after cultured at 40 C for 24 h These data indicated that the like