【病毒外文文獻(xiàn)】2009 Identification of Major Histocompatibility Complex Class I C Molecule as an Attachment Factor That Facilitates Coro

《【病毒外文文獻(xiàn)】2009 Identification of Major Histocompatibility Complex Class I C Molecule as an Attachment Factor That Facilitates Coro》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2009 Identification of Major Histocompatibility Complex Class I C Molecule as an Attachment Factor That Facilitates Coro（10頁珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

JOURNAL OF VIROLOGY Jan 2009 p 1026 1035 Vol 83 No 2 0022 538X 09 08 00H110010 doi 10 1128 JVI 01387 08 Copyright 2009 American Society for Microbiology All Rights Reserved Identification of Major Histocompatibility Complex Class I C Molecule as an Attachment Factor That Facilitates Coronavirus HKU1 Spike Mediated Infection H17188 Che Man Chan 2 Susanna K P Lau 1 2 3 Patrick C Y Woo 1 2 3 Herman Tse 1 2 3 Bo Jian Zheng 1 2 3 Ling Chen 4 Jian Dong Huang 5 and Kwok Yung Yuen 1 2 3 State Key Laboratory of Emerging Infectious Diseases 1 Department of Microbiology 2 and the Carol Yu Centre for Infection 3 of The University of Hong Kong Hong Kong The Guangzhou Institute of Biomedicine and Health Chinese Academy of Sciences Guangzhou China 4 and Department of Biochemistry The University of Hong Kong Hong Kong 5 Received 2 July 2008 Accepted 27 October 2008 Human coronavirus HKU1 HCoV HKU1 is a recently discovered human coronavirus associated with respiratory tract infections worldwide In this study we have identified the major histocompatibility complex class I C molecule HLA C as an attachment factor in facilitating HCoV HKU1 spike S mediated infection HCoV HKU1 S pseudotyped virus was assembled using a human immunodeficiency virus type 1 derived reporter virus harboring the human codon optimized spike of HCoV HKU1 We identified human alveolar epithelial A549 cells as the most susceptible cell line among those tested to infection by HCoV HKU1 S pseudotypes A549 cells were shown to bind purified soluble HCoV HKU1 S 1 600 glycopeptide To search for the functional receptor for HCoV HKU1 an A549 cDNA expression library was constructed and transduced into the nonpermissive baby hamster kidney cells line BHK 21 Transduced cells that bind soluble HCoV HKU1 S 1 600 glycoprotein with C terminal FLAG were sorted Sequencing of two independent clones revealed cDNA inserts encoding HLA C Inhibition of HLA C expression or function by RNAi silencing and anti HLA C antibody decreased HCoV HKU1 S pseudotyped virus infection of A549 cells by 62 to 65 whereas pretreat ment of cells with neuraminidase decreased such infection by only 13 When HLA C was constitutively expressed in another nonpermissive cell line NIH 3T3 quantitative PCR showed that the binding of HCoV HKU1 S pseudotyped virus to cell surfaces was increased by 200 fold but the cells remained nonsusceptible to HCoV HKU1 S pseudotyped virus infection Our data suggest that HLA C is involved in the attachment of HCoV HKU1 to A549 cells and is a potential candidate to facilitate cell entry However other unknown surface proteins on A549 cells may be concomitantly utilized by S glycoprotein of HCoV HKU1 during viral entry Further studies are required to elucidate other putative receptors or coreceptors for HCoV HKU1 and the mechanism of HCoV HKU1 S mediated cell entry The genus of Coronavirus consists of three groups of coro naviruses which are enveloped single stranded positive sense RNA viruses with a genome size of about 30 kb They are known to cause respiratory or intestinal infections in human and other animals Human coronavirus HKU1 HCoV HKU1 a recently identified coronavirus associated with hu man respiratory tract infections first discovered in Hong Kong is classified as a group 2 coronavirus 36 38 At least three genotypes of HCoV HKU1 have been found and shown to have arisen from intergenotype recombination 37 39 Coronaviruses may overcome the entry or interspecies barrier or develop additional host receptor interactions through muta tions or incorporation of foreign sequences into the spike S protein This might explain the diversity of receptor usage among coronaviruses which allows them to exploit different strategies in gaining host cell entry by utilizing a range of cellular proteins and or coreceptors A number of group 1 coronaviruses utilize species specific aminopeptidase N APN a family of metallopro teases as functional receptors Indeed feline APN can serve as a common receptor for group 1 coronaviruses affecting feline ca nine porcine and human species 11 20 30 41 However HCoV NL63 a newly discovered group 1 coronavirus was found to utilize angiotensin converting enzyme 2 ACE2 as an entry receptor 26 The receptor used by some members of group 1 coronavirus such as porcine epidemic diarrhea virus and type I feline infectious peritonitis virus has not been identified The sialic acid N acetyl 9 O acetylneuraminic acid was shown to be the functional receptor for group 2 coronaviruses such as HCoV OC43 and bovine coronaviruses BCoV 13 27 33 But mouse hepatitis virus MHV also a group 2 coronavirus has evolved to use a carcinoembryonic antigen cell adhesion molecule CEACAM1 as the major receptor and heparan sulfate which may function either as the receptor or as an attachment factor depending on the strain 10 29 34 Severe acute respiratory syndrome coronavirus SARS CoV a distantly related group 2 coronavirus uses ACE2 independently with or without DC SIGN and related proteins to mediate infection 22 For group 3 coro naviruses the reported use of sialic acids as the receptor is con sidered controversial and heparan sulfate has been reported to act as an attachment factor for infectious bronchitis virus IBV 23 Feline APN had been ruled out as a functional receptor for avian IBV 5 The HCoV HKU1 S protein contains a predicted furin cleav Corresponding author Mailing address Department of Microbi ology 423 University Pathology Building Queen Mary Hospital The University of Hong Kong Hong Kong Phone 852 2855 4892 Fax 852 2855 1241 E mail hkumicro hkucc hku hk H17188 Published ahead of print on 5 November 2008 1026 on March 24 2015 by guest http jvi asm org Downloaded from age site between the S1 and S2 subdomains Inhibition of the cleavage of recombinant HCoV HKU1 S protein by a furin in hibitor is concentration dependent in a cell based proteolysis as say 3 The S1 subdomain residues 14 to 760 presumably con tains the receptor binding region 36 However the identity of the host receptor is still unknown As HCoV HKU1 cannot be maintained in cell culture yet the identification of the receptor will be critical in understanding the biology and entry mechanism of this elusive virus In this study we identified human lung epi thelial cell line A549 to be highly susceptible to HCoV HKU1 S bearing pseudotyped virus By adopting an expression cloning approach we transduced an A549 derived retroviral cDNA li brary into nonsusceptible hamster kidney BHK 21 cells Trans duced cells that bound soluble codon optimized C terminally FLAG tagged HCoV HKU1 S glycoprotein amino acids 1 to 600 were sorted by flow cytometry The HCoV HKU1 S binding cells were revealed to have incorporated a cDNA transcript iden tical to that of human HLA C molecules which were subse quently confirmed to function as an attachment factor by enhanc ing virus binding onto cell surfaces MATERIALS AND METHODS Cell lines and cultures A panel of cell lines was tested for susceptibility to infection by HCoV HKU1 pseudotyped virus including A549 human alveolar basal epithelial adenocarcinoma HEp 2 human larynx carcinoma MRC 5 human lung fibroblast Huh 7 human hepatoma CaCO2 human colon ad enocarcinoma HRT 18 human rectum anus adenocarcinoma RD human rhabdomyosarcoma embryonic muscle NIH 3T3 mouse embryonic fibroblast 293T human embryonic kidney fibroblast ACE2 293T ACE2 stably expressed in 293T a kind gift from M Farzan 22 BSC 1 African green monkey kidney epithelial Vero E6 African green monkey kidney fibroblast MDCK canine kidney epithelial LLC Mk2 rhesus monkey kidney epithelial and BHK 21 hamster kidney fibroblast Fig 1 Cell lines were propagated in Dulbecco modified Eagle medium DMEM Invitrogen containing 10 fetal calf serum FCS 20 mM HEPES and 1 penicillin streptomycin Invitrogen Plasmid construction The synthetic human codon optimized S gene was used as a PCR template for all S plasmid constructions For pcDNA S forward primer 5H11032 CGCGGATCCCACCATGCTGCTGATCATCTTCATCCTG containing an N terminal signal sequence with a BamHI site and Kozak sequence and reverse primer 5H11032 CGGAATTCCTAGTCATCATGGGAGGTCTTGAT containing a C terminal cytoplasmic domain with an EcoRI site were used to generate full length S in pcDNA 3 1 H11001 For the construction of S1 the same 5H11032 forward sequence was used together with the S1 reverse primer 5H11032 GCGGATCCCTAGTTGATGCCAT TCAGG with a BamHI site It was then subcloned with the C terminus fused in frame with the FLAG sequence DYKDDDDK into the BamHI site of the pSFV1 vector kindly provided by P Liljestrom resulting in plasmid pSFV S1 FLAG For the construction of HLA C into the pSFV 1 vector forward primer 5H11032 CGCGGATCCCACCATGCGGGTCATGGCGCCCCG and reverse primer 5H11032 CGCGGATCCTCAGGCTTTACAAGTGATGAG containing BamHI sites were used resulting in pSFV HLA C For the construction of HLA C into pFB Neo Stratagene for stable expression forward primer 5H11032 CCGGAATTCCACCATGC GGGTCATGGCGCCCCG with an EcoRI site and reverse primer 5H11032 TACGCC FIG 1 Tissue tropism demonstrated by infectivity of HCoV HKU1 S bearing pseudotyped virus in different cell lines A Three different doses of pseudotyped viruses infected different cell lines at a cell density of 1 H11003 10 5 per well in a 24 well plate Infectivity was measured by expression of the reporter eGFP by flow cytometry VSV G was included as a positive control A total of 1H11003 HKU1 pseudotyped virus is equivalent to 12 5 ng quantified by detection of p24 Percentage of infection is measured by GFP expression of infected cells over the total cell population B Infectivity of A549 cells by CoV HKU1 S pseudotyped virus was viral load dependent and saturation was achieved at H1101140 ng The ACE2 transduced 293T cell line is a kind gift from M Farzan 22 VOL 83 2009 MHC CLASS I ANTIGEN AS ATTACHMENT FACTOR FOR HCoV HKU1 1027 on March 24 2015 by guest http jvi asm org Downloaded from TCGAGTCAGGCTTTACAAGTGATGAG with an XhoI site were used result ing in HLA C pFB Neo Production of HCoV HKU1 pseudotyped virus by cotransfection 293FT cells were cultured in DMEM containing 10 FCS 20 mM HEPES and 1 peni cillin streptomycin 293FT cells were maintained separately with the addition of 0 1 mM MEM nonessential amino acids and 500 H9262g ml Geneticin Invitrogen Lentivirus based HCoV HKU1 S pseudotypes were generated by cotransfec tion of 293FT cells with pcDNA S in combination with the pHIV backbone plasmid bearing green fluorescent protein GFP reporter gene pNL4 3 deltaE eGFP using Lipofectamine 2000 agent as suggested by the supplier Invitrogen 42 pcDNA S was replaced with pHEF VSVG to produce pseudotyped virus bearing vesicular stomatitis virus G glycoprotein VSV G envelopes as control 4 Both pNL4 3 deltaE eGFP and pHEF VSVG were obtained through the NIH AIDS research and reference reagents program Cells transfected overnight were replenished with fresh medium and supple mented with 1 mM MEM sodium pyruvate Invitrogen The viral particles in supernatant were harvested 48 h posttransfection and filtered through a 0 45 H9262m pore size syringe filter Viral particles were concentrated by high speed centrifugation at 50 400 H11003 g for 4 h Beckman rotor JA 21 The p24 concen trations from different batches of pseudotyped virus produced were quantified by the p24 enzyme linked immunoassay kit bioMe rieux and stored in aliquots at H1100280 C HCoV HKU1 S pseudotyped virus infection assay Different doses of HCoV HKU1 S retroviral based pseudotyped viruses equivalent to 12 5 25 and 37 5 ng HIV p24 were used to infect tested cell lines cultured in 24 well plates with 10 5 cells well Viruses and cells were incubated at 37 C for1hinFCS free DMEM containing Polybrene Sigma at a concentration of 8 mg ml The medium was replaced with fresh medium with 10 FCS after 1 h and cells were cultured for another 40 h Cells were detached and washed and GFP expression was detected by FACSCalibur flow cytometry Becton Dickinson Soluble HCoV HKU1 S1 protein expression and binding The soluble HCoV HKU1 S1 fragment amino acid positions 1 to 600 was expressed in Semliki Forest virus expression system 22a HCoV HKU1 S1 FLAG protein was im munoprecipitated from supernatant cleared from cell debris by using anti FLAG M2 monoclonal antibody conjugated agarose beads Sigma overnight at 4 C with gentle rocking Bound proteins were pelleted at 8 000 H11003g for 1 min washed three times in 1H11003 washing buffer 10 mM Tris pH 7 5 150 mM NaCl and eluted with 3H11003 FLAG peptide according to the supplier s instructions Sigma Eluted proteins were analyzed by running them on a NuPAGE 4 12 sodium dodecyl sulfate polyacrylamide gel Invitrogen under reducing conditions For the binding assay 1 H9262g purified HCoV HKU1 S1 protein was added to 10 5 A549 cells suspended in 0 1 ml fluorescence activated cell sorter FACS buffer 2 FCS in phosphate buffered saline PBS and incubated at 4 C for 1 h The cell protein mixture was washed and resuspended in 0 1 ml FACS buffer con taining 1 H9262g anti FLAG fluorescein isothiocyanate FITC conjugated antibody Sigma and incubated at 4 C for 1 h HCoV HKU1 S1 protein bound cells were measured by FACSCalibur flow cytometry To verify the specificity of binding HCoV HKU1 S1 was preincubated with convalescent serum of HCoV HKU1 infected patients and serum of normal donors 1 50 dilution for1hat4 Cprior to cell binding Construction of the A549 cDNA library Total RNA was extracted from A549 cells by using an RNeasy kit Qiagen Poly A RNA was then isolated using an Oligotex column Qiagen A total of 5 H9262g mRNA was used to prepare a cDNA library by using the Uni ZAP XR library construction kit Stratagene A cDNA library with cDNA sizes ranging from 1 to 5 kb flanked with 5H11032 EcoRI and 3H11032 XhoI adapters was ligated into a prelinearized pFB retroviral vector Strat agene The ligated cDNAs were transformed into Escherichia coli XL10 Gold competent cells Stratagene Expression library cloning and flow cytometry sorting A total of 10 H9262g cDNA plasmids were cotransfected with 10 H9262g ViraPort gag pol expression vectors and 5 H9262g env expressing VSV G vectors Stratagene using the Lipofectamine 2000 agent Invitrogen for every 10 7 293FT cells Invitrogen Cells transfected over night were replenished with fresh DMEM containing 10 FCS and supple mented with 1 mM minimum essential medium with nonessential amino acids and sodium pyruvate Culture supernatant was harvested 48 h later and filtered through a 0 45 H9262m pore size syringe filter Viral particles were concentrated by high speed centrifugation at 50 400 H11003 g for 4 h Production of pseudotyped virus was quantified by the p24 enzyme linked immunosorbent assay kit and the multiplicity of infection MOI was determined by comparing to pseudotypes containing the ViraPort pFB GFP control vector Stratagene measured by FACSCalibur flow cytometry Pseudotypes carrying the cDNA library were used to transduce 3 H11003 10 6 BHK 21 cells at MOIs of 1 to 2 in the presence of Polybrene 8 mg ml Pseudotypes were incubated for4hat37 C to be adsorbed onto cells An S1 binding assay was performed 48 h postinfection Transduced cells bound to S1 were selected by FACS sorting FACSVantage SE Becton Dickinson Untrans duced BHK 21 cells stained against S1 FLAG FITC were included as back ground control DNA sequencing of cDNA inserts encoding putative attachment factor Fluo rescent cells recovered by FACS sorting were cultured in DMEM containing 10 FCS for 5 days Genomic DNA was isolated using a DNeasy kit Qiagen PCRs of proviral cDNA inserts from sorted transduced cells were performed using pFB vector specific primers flanking a multiple cloning site Stratagene PCR products were ligated to a TA TOPO vector Invitrogen cDNA inserts were sequenced using M13 forward and reverse primers HLA C coimmunoprecipitation A total of 2 H9262g S1 FLAG was preadsorbed onto M2 affinity agarose beads Sigma and incubated with BHK 21 cell lysate transfected with pSFV HLA C for2hat4 Cwith gentle rocking Beads were washed four times with lysis buffer 10 mM Tris buffer pH 7 5 150 mM NaCl 2 mM EDTA 1 Triton X 100 Precipitant complexes were resolved on a NuPAGE 4 12 gel and detected with anti FLAG M2 HRP conjugates 1 500 Sigma and goat anti human HLA C antibodies 1 200 Santa Cruz and goat anti human immunoglobulin G IgG HH11001L 1 5 000 Invitrogen Controls were included by using 2 5 H9262g E coli bacterial alkaline phosphatase BAP FLAG Sigma preadsorbed onto M2 affinity beads and 50 H9262g untransfected BHK 21 cell lysate HLA C knockdown in A549 cells and constitutive expression of HLA C in NIH 3T3 cells Stealth RNAi siRNA targeted against human HLA C was purchased from Invitrogen catalog number 1299003 A total of 6 pmol of stealth RNAi duplex was used to transfect 0 5 H11003 10 5 A549 cells by using RNAi Max Invitrogen After 24 h posttransfection A549 cells were checked for reduction in HLA C level by reverse transcription PCR RT PCR HLA C forward primer 5H11032 GGACAAGAGCAGAGATACACG and reverse primer 5H11032 GAGAGACTCATCAGAGCCCT Western blot analysis immunofluores cence and flow cytometry For stable expression of HLA C ViraPort pseudotypes carrying HLA C pFB Neo were used to infect NIH 3T3 cells Infected cells were selected under Geneticin Invitrogen at 500 H9262g ml Selected cells were verified for HLA C expression Immunofluorescence microscopy for HLA C expression To evaluate the sur face expression of HLA C expression in transduced NIH 3T3 cells and siRNA treated A549 cells cells grown on coverslips were fixed in PBS containing 4 paraformaldehyde for 15 min and quenched in PBS containing 50 mM NH 4 Cl for 10 min at room temperature Unpermeabilized cells were blocked for1hatroom temperature in PBS containing 10 FCS and 5 normal goat serum Invitro gen Cells were incubated for 1 h with goat anti human HLA C 200 H9262g ml Santa Cruz Biotechnology 1 200 in PBS with 2 goat serum and then washed and stained with anti human FITC conjugated secondary antibodies 1 500 In vitrogen for 30 min Coverslips were washed and mounted onto slides by using antifade medium containing DAPI 4H11032 6 diamidino 2 phenylindole Invitrogen prior to image analysis by fluorescence microscopy Eclipse 80i Nikon Real time PCR quantitation of HCoV HKU1 pseudotyped virus attached on cell surfaces A total of 40 ng HCoV HKU1 pseudotypes were inoculated in A549 cell culture with and without HLA C knockdown and in NIH 3T3 cell culture with and without HLA C transfection at cell densities of 10 5 well in a 24 well plate for1hat4 C After three washes total RNA was recovered from cells in each well by using RNeasy Qiagen the copy number of attached virus was estimated by real time PCR using primers and conditions adapted from Brussel and Sonigo 2 for detection of the human immunodeficiency virus HIV RNA viral genome matching the pseudoviral backbone vector pNL4 3 delta E eGFP positions 557 to 690 42 For normalization of the mRNA amount human and mouse H9252 actins in each sample were quantified All PCRs were performed under the recommended conditions for LightCycler FastStart Sybr green Roche as follows 1 cycle at 95 C for 10 min then 40 cycles at 95 C for 10 s 50 C for 5 s and 72 C for 10 s and 1 cycle for the melting curve The copy number of the HCoV HKU1 pseudotype viral genome was compared to that from a serial dilution of HIV standard templates in the TA vector Invitrogen Primers for amplifications were as follows HIV forward primer 5H11032 TGTGTGC CCGTCTGTTGTGT and reverse primer 5H11032 GATCTCTCGACGCAGGACTC human H9252 actin forward primer 5H11032 CGTACCACTGGCATCGTGAT and reverse primer 5H11032 GTGTTGGCGTACAGGTCTTTG mouse H9252 actin forward primer 5H11032 CGTGGGCCGCCCTAGGCACCA and reverse primer 5H11032 TTGGCCTTAG GGTTCAGGGGGG Quantitation of surface HLA C molecule expression by measuring MEFL Tested cells were surface stained with goat anti human HLA C 200 H9262g ml Santa Cruz at a 1 150 dilution and co