【病毒外文文獻(xiàn)】2014 Protein Interferon-Stimulated Gene 15 Conjugation Delays but Does Not Overcome Coronavirus Proliferation in a Model

《【病毒外文文獻(xiàn)】2014 Protein Interferon-Stimulated Gene 15 Conjugation Delays but Does Not Overcome Coronavirus Proliferation in a Model》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2014 Protein Interferon-Stimulated Gene 15 Conjugation Delays but Does Not Overcome Coronavirus Proliferation in a Model（43頁(yè)珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

1 Protein ISGylation delays but does not overcome coronavirus proliferation in a model of 1 fulminant hepatitis 2 3 Xue Zhong Ma 1 Agata Bartczak 1 Jianhua Zhang 1 Wei He 1 Itay Shalev 1 David Smil 2 Limin 4 Chen 1 Jim Phillips 1 Jordan J Feld 3 Nazia Selzner 1 Gary Levy 1 Ian McGilvray 1 5 6 Multi Organ Transplant Program University Health Network University of Toronto Toronto 7 Ontario Canada 1 Structural Genomics Consortium University of Toronto Toronto Ontario 8 Canada 2 Toronto Centre for Liver Disease McLaughlin Rotman Centre for Global Health Uni 9 versity of Toronto Toronto Canada 3 10 11 Short Title ISGylation is antiviral to Coronavirus 12 13 Word Count Abstract 235 Article 5 600 14 15 Ian D McGilvray 16 11C1250 NCSB Toronto General Hospital 17 585 University Avenue 18 Toronto Ontario M5G 2N2 19 Phone 416 340 5230 20 Fax 416 340 5242 21 Email ian mcgilvray uhn ca 22 Xue Zhong Ma and Agata Bartczak contributed equally to this work 23 24 JVI Accepts published online ahead of print on 19 March 2014 J Virol doi 10 1128 JVI 03801 13 Copyright 2014 American Society for Microbiology All Rights Reserved 2 Abstract 25 Coronaviruses express a de ubiquitinating protein the papain like protease 2 PLP2 that re 26 moves both ubiquitin and the ubiquitin like Interferon IFN Stimulated Gene 15 ISG15 protein 27 from target proteins ISG15 has antiviral activity against a number of viruses therefore we exam 28 ined the effect of ISG15 conjugation ISGylation in a model of acute viral hepatitis induced by 29 the murine hepatitis virus MHV 3 coronavirus Mice deficient in the ISG15 deconjugating en 30 zyme ubiquitin specific peptidase 18 USP18 accumulate high levels of ISG15 conjugated pro 31 teins and are hypersensitive to type I IFN Infecting USP18 mice with MHV 3 resulted in ex 32 tended survival 8 1 2 vs 4 days and improved liver histology a decreased inflammatory re 33 sponse and 1 2 logs lower viral titers compared to USP18 mice The suppression of viral rep 34 lication was not due to increased IFN since infected USP18 mice had neither increased hepatic 35 IFN or mRNA nor circulating protein Instead delayed MHV 3 replication coincided 36 with high levels of cellular ISGylation Decreasing ISGylation by knockdown of the ISG15 E1 37 enzyme Ube1L in primary USP18 and USP18 hepatocytes led to increased MHV 3 replica 38 tion Both in vitro and in vivo increasing MHV 3 titers were coincident with increased PLP2 39 mRNA and decreased ISGylation over the course of infection The pharmacologic inhibition of 40 the PLP2 enzyme in vitro led to decreased MHV 3 replication Overall these results demonstrate 41 the antiviral effect of ISGylation in an in vivo model of coronavirus induced mouse hepatitis and 42 illustrate that PLP2 manipulates the host innate immune response through the ISG15 USP18 43 pathway 44 3 Statement of Importance 45 There have been a number of serious worldwide pandemics due to widespread infections by 46 Coronavirus This virus in its many forms is difficult to treat in part because it is very good at 47 finding holes in the way that the host the infected individual tries to control and eliminate the 48 virus In this study we demonstrate that an important host viral defence the ISG15 pathway is 49 only partially effective in controlling severe Coronavirus infection Activation of the pathway is 50 very good at suppressing viral production but over time the virus overwhelms the host response 51 and the effects of the ISG15 pathway This data provides insight into the host viral interactions 52 during Coronavirus infection and suggests that the ISG15 pathway is a reasonable target for con 53 trolling severe Coronavirus infection though the best treatment will likely involve multiple 54 pathways and targets 55 56 4 Introduction 57 Coronaviruses cause both common and severe clinical illness as manifested by the Se 58 vere Acute Respiratory Syndrome SARS epidemic During the 2002 2003 SARS epidemic 59 8422 people were affected of whom 916 died from acute respiratory distress syndrome 1 2 60 The episodic re emergence of severe coronavirus infections most recently in the fall of 2012 and 61 continuing into 2013 highlights the need for treatments against Coronavirus infections 3 62 Coronaviruses are positive stranded enveloped RNA viruses with some of the largest vi 63 ral genomes ranging between 26 32kDa Coronaviruses target a myriad of distinct animal hosts 64 and cause disease in a number of organs such as the brain liver and lung Organ damage from 65 severe coronavirus infections is generally the result of an over exuberant activation of host in 66 nate immune mechanisms 4 5 For example Murine Hepatitis strain 3 MHV 3 infection of 67 susceptible mouse strains is a model of strong innate immune activation resulting in fulminant 68 viral hepatitis 6 Following infection by MHV 3 mice die in 3 4 days of hepatic parenchymal 69 destruction mediated by a robust activation of local innate immunity 7 9 Understanding the 70 limits of host immunity in the MHV 3 model may identify novel targets for the treatment of se 71 vere Coronavirus infections 72 Interferon IFN stimulation as well as bacterial and viral infection induces the expression 73 of IFN stimulated genes ISGs One of the most abundantly expressed ISGs is ISG15 a 15 kDa 74 protein 10 ISG15 is conjugated to target proteins the process of ISGylation through consecu 75 tive interactions with an E1 activating enzyme Ube1L an E2 conjugating enzyme UbcH6 or 76 UbcH8 and an E3 ligase Herc5 EFP HHARI 11 Over 160 proteins have been identified as 77 targets of ISG15 including proteins involved in processes such as protein translation cell cycle 78 regulation and immune regulation 11 13 Several ISG15 downstream targets are involved in the 79 5 regulation of IFN signalling including retinoic acid inducible gene 1 RIG 1 signal transducer 80 and activator of transcription 1 STAT 1 janus activated kinase 1 JAK 1 and MxA 12 14 81 Although the ISG15 protease function has the potential to modulate IFN responses this role has 82 not been consistently demonstrated 15 The effect of ISGylation on downstream proteins is 83 multifaceted as ISGylation has been reported to disrupt target protein function and or alter cellu 84 lar localization 16 17 85 The conjugation of ISG15 to protein targets is offset by the deconjugating activity of the 86 ubiquitin specific peptidase 18 USP18 USP18 like ISG15 is an ISG which is up regulated 87 after stimulation by IFN or by viral and bacterial infection USP18 is specific for ISG15 and 88 strips ISG15 from target proteins through its isopeptidase activity 18 USP18 mice have 89 markedly increased cellular ISGylation and are hyper sensitive to the effects of Type 1 IFN 19 90 21 The latter effect is independent of the isopeptidase activity and instead due to the ability of 91 USP18 to modulate IFN signalling by binding to the IFN receptor 2 IFNAR2 22 Thus 92 USP18 has several functions important to the host innate immune response by binding to the 93 IFNAR2 it can modulate the IFN response and through its ISG15 isopeptidase function it regu 94 lates the cellular ISGylation levels However the implications of the balance of ISGylation and 95 USP18 isopeptidase activity require further elucidation 96 The role of ISGylation in viral lifecycles is specific to the virus involved ISGylation can 97 exert an antiviral pressure against some infections but can also stimulate viral replication in oth 98 ers For example USP18 deficient mice have increased ISGylation and are more resistant to 99 lymphocytic choriomeningitis virus LCMV and herpes simplex virus HSV models of fatal 100 viral encephalitis 20 During human immunodeficiency virus HIV infection the conjugation 101 of ISG15 to the HIV Gag protein arrests assembly of the Gag particle on the plasma membrane 102 6 23 and inhibits viral replication On the other hand we have found that ISGylation is necessary 103 for robust production of HCV in human hepatocytes 24 and both ISG15 and USP18 are up 104 regulated in the hepatocytes of patients with chronic HCV who do not respond to exogenous IFN 105 treatment 25 27 106 Previously we demonstrated that coronavirus replication in vivo is held in check by host 107 ubiquitination 28 Inhibition of the cellular proteasome leads to increased cellular ubiquitina 108 tion levels and an early interruption in coronavirus replication Coronaviruses have evolved 109 counter measures to such host cellular antiviral mechanisms In this case the de ubiquitination 110 protein papain like protease 2 PLP2 strips ubiquitin from target proteins 29 The PLP2 pro 111 tein is not specific to ubiquitin it acts on both ubiquitin and the ubiquitin like protein ISG15 112 This suggests that ISG15 and its conjugation to cellular proteins may also exert an antiviral pres 113 sure effect against coronavirus infection Moreover several reports indicate that PLP2 has a 60 114 fold higher affinity for ISG15 conjugated rather than Ub modified substrates 18 30 However 115 it is unknown whether targeting PLP2 activity in an in vitro cell culture system or in vivo will 116 inhibit coronavirus replication Furthermore questions remain as to whether ISGylation itself is 117 antiviral against coronavirus infection and or whether the PLP2 machinery in vitro targets ISGy 118 lation directly to evade the host response 119 In the present study we infected USP18 mice with the coronavirus MHV 3 to evaluate 120 the involvement of the ISG15 USP18 pathway to the virulence of MHV 3 induced hepatitis We 121 found that USP18 mice are more resistant to MHV 3 infection but that the virus gradually 122 overcomes this protective effect IFN type 1 and type 2 expression levels were not increased in 123 USP18 mice following infection by MHV 3 allowing us to study the role of increased baseline 124 ISGylation in the absence of IFN signalling Silencing ISGylation reverses the antiviral milieu 125 7 and leads to increased MHV 3 replication Both in vitro and in vivo viral persistence is accom 126 panied by increased expression of the PLP2 protein PLP2 expression is important for allowing 127 viral replication specific PLP inhibitors decreased viral protein expression Overall these results 128 demonstrate both the role and the limits of the antiviral effect of ISGylation in severe coronavi 129 rus infection 130 131 8 Materials and Methods 132 Animals 133 C57BL 6 USP18 and USP18 mice between 6 8 weeks old were used for experiments These 134 mice were the kind gift of Dong Er Zhang Scripps UCSD Animals were housed in SPF condi 135 tions at the MaRS TMDT Animal Resource Centre Toronto and were given chow and water ad 136 libitum Following MHV 3 infection animals were housed in sterile cages in a level 2 facility in 137 the MBRC Toronto Mice infected with MHV 3 were sacrificed at humane endpoints Animals 138 were treated according to the guidelines of the Canadian Council on Animal Care and were ap 139 proved by the University Health Network Animal Care Committee 140 141 Isolation of Peritoneal exudative macrophages PEM and Hepatocytes 142 The isolation of PEM has been previously described 28 Briefly mice were injected with 2ml 143 of sterile 3 thioglycollate Animals were sacrificed after 3 days and PEM were retrieved by 144 washing the intraperitoneal cavity with 10ml ice cold Hank s buffered salt solution HBSS Life 145 Technologies Cells were washed 2 fold spun down at 300 g and re suspended in Dulbecco s 146 Modified Eagle Medium DMEM Life Technologies supplemented with L Gln Using this 147 method the purity of PEM was found to be 90 with a viability of 97 by Trypan blue ex 148 clusion For experiments PEM were plated on polystyrene plates at a density of 1 10 6 cells ml 149 and incubated for 24h at 37 C and 5 CO 2 Non adherent cells were then washed away 150 Primary hepatocytes were isolated as previously described 31 32 Briefly mice were anesthe 151 tised with 50 mg kg of pentobarbital i p The portal vein was canulated with a 21 gauge needle 152 The liver was flushed via the portal vena cava with perfusion solution 2 5mM EGTA in HBSS 153 without Ca 2 or Mg 2 at 37 C and a rate of 7ml min using an infusion pump for 3min The liver 154 9 was then perfused with solution 2 0 02 collagenase IV Sigma Aldrich with calcium and 155 magnesium in HBSS at the same pressure The liver was then carefully harvested into a Petri 156 dish containing DMEM 15 and 1 10 7 M insulin Sigma Aldrich and minced This solution 157 was filtered through a 120 m nylon mesh and centrifuged for 2min at 40 g at room tempera 158 ture RT Cells were washed 2 times with DMEM insulin Cells were counted on a hemocy 159 tometer and viability was determined by Trypan blue exclusion Hepatocytes were plated at a 160 density of 1 10 5 cells ml in DMEM supplemented with 1 10 7 M insulin on a 6 well plate 161 Corning Inc Hepatocytes were incubated for 2 hours and the medium was replaced with serum 162 free DMEM supplemented with 1 10 7 M insulin Hepatocytes were inoculated with MHV 3 163 multiplicity of infection MOI 1 0 1 or 0 01 and incubated for 1h Cells were then washed 164 with serum free medium 1 10 7 M insulin and cultured for the indicated time 165 166 Virus viral infection and viral titering 167 MHV 3 virus was grown to titers of 10 50 10 6 PFU ml RPMI on confluent 17CL cells To de 168 termine viral titers harvested cells or liver tissue were lysed or homogenized in ice cold 169 DMEM 10 using a TissueLyser QIAGEN MHV 3 titers were assessed on monolayers of L2 170 cells in a standard plaque assay 6 For in vivo studies mice were infected i p with 50 PFU of 171 MHV 3 and housed in sterile conditions Animals were monitored daily and sacrificed at a hu 172 mane end point 173 174 Histology 175 Tissues were harvested and preserved in 10 buffered formalin Fixed tissues were paraffin em 176 bedded and cut into 5 m sections by the Department of Pathology at the Hospital for Sick Chil 177 10 dren Toronto Sections were stained with Hematoxylin and Eosin using standard protocols 33 178 Sections were scored in a blinded fashion by an experienced liver pathologist M J P Sections 179 were assessed for inflammation parenchymal changes and tissue necrosis 180 181 Measurement of alanine transaminase ALT and aspartate aminotransferase AST in the 182 serum 183 Blood was harvested by cardiac puncture and was incubated for 10min at RT Samples were 184 spun down at 2 000 g and the serum was collected for analysis ALT AST levels were meas 185 ured using the Vitro DT60 II Chemistry System Ortho Clinical Diagnostics Neckargemund 186 Germany 187 188 Serum protein levels of type I and type II IFN 189 Blood was harvested from mice by cardiac puncture Serum was incubated at 4 C overnight 190 O N The samples were centrifuged at 2 000 g for 10min and the serum was removed to a 191 fresh tube ELISA kits for IFN and IFN were purchased from PBL Interferon Source Pis 192 cataway Township NJ USA The ELISA kit for IFN was purchased from BioLegend Inc 193 San Diego CA USA ELISA tests were performed according to manufacturer s instructions 194 195 Real Time PCR 196 Mice were infected with MHV 3 and sacrificed on the indicated day s Total RNA was ex 197 tracted from liver tissue using TRIzol reagent Invitrogen according to manufacturer s specifica 198 tions The isolated RNA was treated with DNase Qiagen and the quality of the RNA was as 199 sessed by measuring 260 280 on a Nanodrop spectrophotometer 1 g of RNA was reverse tran 200 11 scribed using the First Strand cDNA Synthesis Kit GE Health Care using random hexamer oli 201 gonucleotides The reverse transcriptase reaction was run as per manufacturer s specifications 202 Primers used for Real Time PCR reactions were based on published and primer bank sequences 203 The following primer sequences were used mouse IFN forward primer 5 204 CTTTGGATTCCCGCAGGA 3 mouse IFN reverse primer 5 TGTAG 205 GACAGGGATGGCTTGA 3 mouse IFN forward primer 5 206 TGAATGGAAAGATCAACCTCACCTA 3 mouse IFN reverse primer 5 207 CTCTTCTGCATCTTCTCCGTCA 3 mouse IFN forward primer 5 208 CAGCAACAGCAAGGCGAAA 3 mouse IFN reverse primer 5 209 CTGGACCTGTGGGTTGTTGAC 3 mouse hypoxanthine phosphoribosyltransferase HPRT 210 forward primer 5 GTTGGATACAGGCCAGACTTTGTT G 3 mouse HPRT reverse primer 5 211 GATTCAACTTGCGCTCATCTTAGGC 3 mouse glyceraldehyde 3 phosphate dehydrogenase 212 GAPDH forward primer 5 ACAACTTTGGCATTGTGGAA 3 mouse GAPDH reverse 213 primer 5 GATGCAGGGATGATGTTCTG 3 MHV 3 PLP2 forward primer 5 214 AAATGTGGCTTGTTTGATGC 3 and MHV 3 PLP2 reverse primer 5 215 CCTTCGCTAAGACCAAGGAC 3 216 Real Time PCR was performed on an ABI PRISM 7900H Applied Biosystems with SYBR 217 Green real time PCR master mix Applied Biosystems according to manufacturer s specifica 218 tions using the 96 well plate format Data was analyzed using SDS 2 2 Software Applied Bio 219 systems using the standard curve method Samples were normalized to HPRT and GAPDH 220 221 Western Blot WB 222 12 Harvested tissues were homogenized and lysed in ice cold cell lysis buffer Cells from in vitro 223 cultures were lysed with 2 Laemmli buffer and 0 1mM DTT Protein concentrations were de 224 termined by the Bradford assay 20 g of proteins was visualized by 10 SDS PAGE gel and 225 transferred to a nitrocellulose membrane Pall Membranes were probed with the following an 226 tibodies anti nucleocapsid N protein mouse monoclonal made in house anti mouse actin 227 mouse monoclonal antibody Sigma anti mouse ISG15 rabbit polyclonal antibody anti mouse 228 Ube1L goat polyclonal IgG or anti mouse STAT1 p84 p91 rabbit polyclonal Santa Cruz Bio 229 technology The corresponding horseradish peroxidase HRP conjugated secondary antibodies 230 were used Sheep anti mouse IgG GE Healthcare donkey anti rabbit IgG Santa Cruz Biotech 231 nology or a donkey anti goat IgG Santa Cruz Biotechnology Blots were developed using the 232 ECL system Amersham Pharmacia Biotech 233 234 Silencing Ube1L expression 235 Isolated primary hepatocytes were plated at a density of 1 10 5 cells ml in DMEM Cells were 236 incubated O N at 37 C 0 5 CO 2 whereupon cells reached 60 80 confluency Cells were 237 transfected with Ube1L siRNA Santa Cruz Biotechnology as per manufacturer s instructions 238 Briefly cells were washed with transfection medium and then overlaid with transfection reagent 239 solution and incubated for 6 h at 37 C DMEM medium including 10 FBS was added and the 240 cells were incubated a total of 24h The medium was replaced with normal growth medium and 241 cells were infected with MHV 3 MOI 1 IFN PBL Interferon Source Samples were har 242 vested 12h p i using 200 l protein lysis buffer BD bioscience run on a 10 SDS PAGE gel 243 and visualized by WB 244 245 13 PLP2 Inhibition 246 PLP2 inhibitors were generated in house according to Ratia et al 34 Isolated PEM were incu 247 bated in the presence of MHV 3 MOI 1 for 1h Medium was washed away and fresh medium 248 100 M inhibitor 6 100 M inhibitor 7 100 M GRL0617 or 100IU ml IFN was added PBL 249 Interferon Source Cells were harvested at 9h p i run on a 10 SDS PAGE gel and visualized 250 by WB 251 252 Statistics 253 Statistical analysis was performed using PRISM software version 5 GraphPad Software Inc 254 Survival curves were calculated using the Log rank Mantel Cox test 255 Data analysis was performed using a 2 way ANOVA followed by a Bonferroni post hoc test 256 unless otherwise noted Data is represented as either mean SD or mean SEM as indicated 257 Results with a p value below 0 05 were considered significant 258 259 260 261 262 263 14 Results 264 USP18 mice have increased survival following MHV 3 infection 265 To test our hypothesis that ISGylation has an antiviral effect on murine hepatitis virus 266 MHV 3 infection we infected USP18 mice which have high baseline levels of ISGylation 267 and control USP18 mice with 50 pfu MHV 3 20 The infection of susceptible C57BL 6 mice 268 with MHV 3 induces a fulminant hepatitis with hepatocel